90
|
Taihe Biotechnology Co Ltd
polynucleotide containing multiple cloning sites and fragments corresponding to amino acid polylinkers Polynucleotide Containing Multiple Cloning Sites And Fragments Corresponding To Amino Acid Polylinkers, supplied by Taihe Biotechnology Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/polynucleotide containing multiple cloning sites and fragments corresponding to amino acid polylinkers/product/Taihe Biotechnology Co Ltd Average 90 stars, based on 1 article reviews
polynucleotide containing multiple cloning sites and fragments corresponding to amino acid polylinkers - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Oligos Etc
multiple cloning site oligos 5′aattaccgcggggcgcgccgtttaaacgcatgccaattgggccggccg3′ (seq id no: 18) Multiple Cloning Site Oligos 5′Aattaccgcggggcgcgccgtttaaacgcatgccaattgggccggccg3′ (Seq Id No: 18), supplied by Oligos Etc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/multiple cloning site oligos 5′aattaccgcggggcgcgccgtttaaacgcatgccaattgggccggccg3′ (seq id no: 18)/product/Oligos Etc Average 90 stars, based on 1 article reviews
multiple cloning site oligos 5′aattaccgcggggcgcgccgtttaaacgcatgccaattgggccggccg3′ (seq id no: 18) - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Promega
palter-ab 3.2-kb hind iii-kpni fragment containing arsab genes cloned into the multiple cloning site of palter™21, (arsab) Palter Ab 3.2 Kb Hind Iii Kpni Fragment Containing Arsab Genes Cloned Into The Multiple Cloning Site Of Palter™21, (Arsab), supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/palter-ab 3.2-kb hind iii-kpni fragment containing arsab genes cloned into the multiple cloning site of palter™21, (arsab)/product/Promega Average 90 stars, based on 1 article reviews
palter-ab 3.2-kb hind iii-kpni fragment containing arsab genes cloned into the multiple cloning site of palter™21, (arsab) - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Promega
multiple cloning site Multiple Cloning Site, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/multiple cloning site/product/Promega Average 90 stars, based on 1 article reviews
multiple cloning site - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Promega
flag tag and part of the multiple cloning site Flag Tag And Part Of The Multiple Cloning Site, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/flag tag and part of the multiple cloning site/product/Promega Average 90 stars, based on 1 article reviews
flag tag and part of the multiple cloning site - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
dna fragment encoding mmbp and a multiple cloning site Dna Fragment Encoding Mmbp And A Multiple Cloning Site, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/dna fragment encoding mmbp and a multiple cloning site/product/GenScript corporation Average 90 stars, based on 1 article reviews
dna fragment encoding mmbp and a multiple cloning site - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Oligos Etc
multiple cloning site Multiple Cloning Site, supplied by Oligos Etc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/multiple cloning site/product/Oligos Etc Average 90 stars, based on 1 article reviews
multiple cloning site - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
5 PRIME
multiple cloning site (mcs) Multiple Cloning Site (Mcs), supplied by 5 PRIME, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/multiple cloning site (mcs)/product/5 PRIME Average 90 stars, based on 1 article reviews
multiple cloning site (mcs) - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Clonexpress inc
multiple cloning site (mcs) 1 Multiple Cloning Site (Mcs) 1, supplied by Clonexpress inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/multiple cloning site (mcs) 1/product/Clonexpress inc Average 90 stars, based on 1 article reviews
multiple cloning site (mcs) 1 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Mobitec Inc
portion of the multiple cloning site Portion Of The Multiple Cloning Site, supplied by Mobitec Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/portion of the multiple cloning site/product/Mobitec Inc Average 90 stars, based on 1 article reviews
portion of the multiple cloning site - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Twist Bioscience
pucx multiple cloning site Pucx Multiple Cloning Site, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pucx multiple cloning site/product/Twist Bioscience Average 90 stars, based on 1 article reviews
pucx multiple cloning site - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
5 PRIME
pds132 multiple cloning site Pds132 Multiple Cloning Site, supplied by 5 PRIME, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pds132 multiple cloning site/product/5 PRIME Average 90 stars, based on 1 article reviews
pds132 multiple cloning site - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |